Knowunity AI

Open the App

Subjects

360

Feb 15, 2026

3 pages

Fun Worksheet: Explore Gene Mutations & Transcribe DNA to mRNA

user profile picture

zy

@zy_xfka

A comprehensive guide to understanding gene mutations worksheet for biology... Show more

Page 1
Page 2
Page 3
1 / 3
# Mutations Worksheet

Part 1: Gene Mutations

In the chart below, transcribe the DNA sequence into mRNA. Then use the codon
chart (below) t

Page 2: Classification of Mutation Types

This page delves deeper into categorizing different types of mutations and their characteristics. It presents a systematic breakdown of point mutations and chromosome mutations through matching exercises.

Definition: Point mutations include substitution, insertion, and deletion of individual nucleotides.

Highlight: Frameshift mutations occur through insertions or deletions that alter the reading frame of genetic code.

Example: A DNA sequence change from AAGGACATTAGC to AGGACATTAGC demonstrates a deletion mutation.

Quote: "Can a point mutation be a frameshift mutation? No"

# Mutations Worksheet

Part 1: Gene Mutations

In the chart below, transcribe the DNA sequence into mRNA. Then use the codon
chart (below) t

Page 3: Protein Synthesis and Mutation Effects

This page examines the practical implications of mutations on protein synthesis through comparative analysis of normal and mutated DNA sequences.

Definition: Protein synthesis is the process of translating genetic information from DNA through mRNA into amino acid sequences.

Example: Normal DNA sequence TACGCCTCACCGCCTATTATC compared with mutated sequences to demonstrate different mutation effects.

Highlight: The page demonstrates how different types of mutations can lead to varying changes in amino acid sequences and protein structure.

Vocabulary:

  • Normal DNA: Original genetic sequence
  • Mutated DNA: Altered genetic sequence
  • Amino acids: Building blocks of proteins
# Mutations Worksheet

Part 1: Gene Mutations

In the chart below, transcribe the DNA sequence into mRNA. Then use the codon
chart (below) t

Page 1: Gene and Chromosome Mutations Introduction

This page introduces fundamental concepts of gene mutations and chromosome alterations through practical exercises. Students learn to transcribe DNA sequences into mRNA and identify resulting amino acids.

Definition: Gene mutations are changes in DNA sequence that can alter protein synthesis and genetic expression.

Example: The transcription of DNA sequence TACGCCAGTGGT to mRNA sequence AUGCGGUCACCA, coding for Met, Arg, Ser, Pro.

Vocabulary:

  • Point mutation: Single nucleotide change
  • Frameshift mutation: Insertion or deletion that shifts reading frame
  • Translocation: Exchange of genetic material between chromosomes

Highlight: The page includes a comprehensive codon chart for translating mRNA sequences to amino acids.



We thought you’d never ask...

What is the Knowunity AI companion?

Our AI companion is specifically built for the needs of students. Based on the millions of content pieces we have on the platform we can provide truly meaningful and relevant answers to students. But its not only about answers, the companion is even more about guiding students through their daily learning challenges, with personalised study plans, quizzes or content pieces in the chat and 100% personalisation based on the students skills and developments.

Where can I download the Knowunity app?

You can download the app in the Google Play Store and in the Apple App Store.

Is Knowunity really free of charge?

That's right! Enjoy free access to study content, connect with fellow students, and get instant help – all at your fingertips.

Can't find what you're looking for? Explore other subjects.

Students love us — and so will you.

4.6/5

App Store

4.7/5

Google Play

The app is very easy to use and well designed. I have found everything I was looking for so far and have been able to learn a lot from the presentations! I will definitely use the app for a class assignment! And of course it also helps a lot as an inspiration.

Stefan S

iOS user

This app is really great. There are so many study notes and help [...]. My problem subject is French, for example, and the app has so many options for help. Thanks to this app, I have improved my French. I would recommend it to anyone.

Samantha Klich

Android user

Wow, I am really amazed. I just tried the app because I've seen it advertised many times and was absolutely stunned. This app is THE HELP you want for school and above all, it offers so many things, such as workouts and fact sheets, which have been VERY helpful to me personally.

Anna

iOS user

I think it’s very much worth it and you’ll end up using it a lot once you get the hang of it and even after looking at others notes you can still ask your Artificial intelligence buddy the question and ask to simplify it if you still don’t get it!!! In the end I think it’s worth it 😊👍 ⚠️Also DID I MENTION ITS FREEE YOU DON’T HAVE TO PAY FOR ANYTHING AND STILL GET YOUR GRADES IN PERFECTLY❗️❗️⚠️

Thomas R

iOS user

Knowunity is the BEST app I’ve used in a minute. This is not an ai review or anything this is genuinely coming from a 7th grade student (I know 2011 im young) but dude this app is a 10/10 i have maintained a 3.8 gpa and have plenty of time for gaming. I love it and my mom is just happy I got good grades

Brad T

Android user

Not only did it help me find the answer but it also showed me alternative ways to solve it. I was horrible in math and science but now I have an a in both subjects. Thanks for the help🤍🤍

David K

iOS user

The app's just great! All I have to do is enter the topic in the search bar and I get the response real fast. I don't have to watch 10 YouTube videos to understand something, so I'm saving my time. Highly recommended!

Sudenaz Ocak

Android user

In school I was really bad at maths but thanks to the app, I am doing better now. I am so grateful that you made the app.

Greenlight Bonnie

Android user

I found this app a couple years ago and it has only gotten better since then. I really love it because it can help with written questions and photo questions. Also, it can find study guides that other people have made as well as flashcard sets and practice tests. The free version is also amazing for students who might not be able to afford it. Would 100% recommend

Aubrey

iOS user

Best app if you're in Highschool or Junior high. I have been using this app for 2 school years and it's the best, it's good if you don't have anyone to help you with school work.😋🩷🎀

Marco B

iOS user

THE QUIZES AND FLASHCARDS ARE SO USEFUL AND I LOVE Knowunity AI. IT ALSO IS LITREALLY LIKE CHATGPT BUT SMARTER!! HELPED ME WITH MY MASCARA PROBLEMS TOO!! AS WELL AS MY REAL SUBJECTS ! DUHHH 😍😁😲🤑💗✨🎀😮

Elisha

iOS user

This app is phenomenal down to the correct info and the various topics you can study! I greatly recommend it for people who struggle with procrastination and those who need homework help. It has been perfectly accurate for world 1 history as far as I’ve seen! Geometry too!

Paul T

iOS user

The app is very easy to use and well designed. I have found everything I was looking for so far and have been able to learn a lot from the presentations! I will definitely use the app for a class assignment! And of course it also helps a lot as an inspiration.

Stefan S

iOS user

This app is really great. There are so many study notes and help [...]. My problem subject is French, for example, and the app has so many options for help. Thanks to this app, I have improved my French. I would recommend it to anyone.

Samantha Klich

Android user

Wow, I am really amazed. I just tried the app because I've seen it advertised many times and was absolutely stunned. This app is THE HELP you want for school and above all, it offers so many things, such as workouts and fact sheets, which have been VERY helpful to me personally.

Anna

iOS user

I think it’s very much worth it and you’ll end up using it a lot once you get the hang of it and even after looking at others notes you can still ask your Artificial intelligence buddy the question and ask to simplify it if you still don’t get it!!! In the end I think it’s worth it 😊👍 ⚠️Also DID I MENTION ITS FREEE YOU DON’T HAVE TO PAY FOR ANYTHING AND STILL GET YOUR GRADES IN PERFECTLY❗️❗️⚠️

Thomas R

iOS user

Knowunity is the BEST app I’ve used in a minute. This is not an ai review or anything this is genuinely coming from a 7th grade student (I know 2011 im young) but dude this app is a 10/10 i have maintained a 3.8 gpa and have plenty of time for gaming. I love it and my mom is just happy I got good grades

Brad T

Android user

Not only did it help me find the answer but it also showed me alternative ways to solve it. I was horrible in math and science but now I have an a in both subjects. Thanks for the help🤍🤍

David K

iOS user

The app's just great! All I have to do is enter the topic in the search bar and I get the response real fast. I don't have to watch 10 YouTube videos to understand something, so I'm saving my time. Highly recommended!

Sudenaz Ocak

Android user

In school I was really bad at maths but thanks to the app, I am doing better now. I am so grateful that you made the app.

Greenlight Bonnie

Android user

I found this app a couple years ago and it has only gotten better since then. I really love it because it can help with written questions and photo questions. Also, it can find study guides that other people have made as well as flashcard sets and practice tests. The free version is also amazing for students who might not be able to afford it. Would 100% recommend

Aubrey

iOS user

Best app if you're in Highschool or Junior high. I have been using this app for 2 school years and it's the best, it's good if you don't have anyone to help you with school work.😋🩷🎀

Marco B

iOS user

THE QUIZES AND FLASHCARDS ARE SO USEFUL AND I LOVE Knowunity AI. IT ALSO IS LITREALLY LIKE CHATGPT BUT SMARTER!! HELPED ME WITH MY MASCARA PROBLEMS TOO!! AS WELL AS MY REAL SUBJECTS ! DUHHH 😍😁😲🤑💗✨🎀😮

Elisha

iOS user

This app is phenomenal down to the correct info and the various topics you can study! I greatly recommend it for people who struggle with procrastination and those who need homework help. It has been perfectly accurate for world 1 history as far as I’ve seen! Geometry too!

Paul T

iOS user

 

Biology

360

Feb 15, 2026

3 pages

Fun Worksheet: Explore Gene Mutations & Transcribe DNA to mRNA

user profile picture

zy

@zy_xfka

A comprehensive guide to understanding gene mutations worksheet for biology students and identifying types of chromosome mutations in genetics, focusing on DNA transcription, mutations, and protein synthesis.

  • Covers essential concepts in genetic mutations including point mutations and chromosome mutations... Show more

# Mutations Worksheet

Part 1: Gene Mutations

In the chart below, transcribe the DNA sequence into mRNA. Then use the codon
chart (below) t

Sign up to see the contentIt's free!

Access to all documents

Improve your grades

Join milions of students

Page 2: Classification of Mutation Types

This page delves deeper into categorizing different types of mutations and their characteristics. It presents a systematic breakdown of point mutations and chromosome mutations through matching exercises.

Definition: Point mutations include substitution, insertion, and deletion of individual nucleotides.

Highlight: Frameshift mutations occur through insertions or deletions that alter the reading frame of genetic code.

Example: A DNA sequence change from AAGGACATTAGC to AGGACATTAGC demonstrates a deletion mutation.

Quote: "Can a point mutation be a frameshift mutation? No"

# Mutations Worksheet

Part 1: Gene Mutations

In the chart below, transcribe the DNA sequence into mRNA. Then use the codon
chart (below) t

Sign up to see the contentIt's free!

Access to all documents

Improve your grades

Join milions of students

Page 3: Protein Synthesis and Mutation Effects

This page examines the practical implications of mutations on protein synthesis through comparative analysis of normal and mutated DNA sequences.

Definition: Protein synthesis is the process of translating genetic information from DNA through mRNA into amino acid sequences.

Example: Normal DNA sequence TACGCCTCACCGCCTATTATC compared with mutated sequences to demonstrate different mutation effects.

Highlight: The page demonstrates how different types of mutations can lead to varying changes in amino acid sequences and protein structure.

Vocabulary:

  • Normal DNA: Original genetic sequence
  • Mutated DNA: Altered genetic sequence
  • Amino acids: Building blocks of proteins
# Mutations Worksheet

Part 1: Gene Mutations

In the chart below, transcribe the DNA sequence into mRNA. Then use the codon
chart (below) t

Sign up to see the contentIt's free!

Access to all documents

Improve your grades

Join milions of students

Page 1: Gene and Chromosome Mutations Introduction

This page introduces fundamental concepts of gene mutations and chromosome alterations through practical exercises. Students learn to transcribe DNA sequences into mRNA and identify resulting amino acids.

Definition: Gene mutations are changes in DNA sequence that can alter protein synthesis and genetic expression.

Example: The transcription of DNA sequence TACGCCAGTGGT to mRNA sequence AUGCGGUCACCA, coding for Met, Arg, Ser, Pro.

Vocabulary:

  • Point mutation: Single nucleotide change
  • Frameshift mutation: Insertion or deletion that shifts reading frame
  • Translocation: Exchange of genetic material between chromosomes

Highlight: The page includes a comprehensive codon chart for translating mRNA sequences to amino acids.

We thought you’d never ask...

What is the Knowunity AI companion?

Our AI companion is specifically built for the needs of students. Based on the millions of content pieces we have on the platform we can provide truly meaningful and relevant answers to students. But its not only about answers, the companion is even more about guiding students through their daily learning challenges, with personalised study plans, quizzes or content pieces in the chat and 100% personalisation based on the students skills and developments.

Where can I download the Knowunity app?

You can download the app in the Google Play Store and in the Apple App Store.

Is Knowunity really free of charge?

That's right! Enjoy free access to study content, connect with fellow students, and get instant help – all at your fingertips.

3

Smart Tools NEW

Transform this note into: ✓ 50+ Practice Questions ✓ Interactive Flashcards ✓ Full Practice Test ✓ Essay Outlines

Practice Test
Quiz
Flashcards
Essay

Can't find what you're looking for? Explore other subjects.

Students love us — and so will you.

4.6/5

App Store

4.7/5

Google Play

The app is very easy to use and well designed. I have found everything I was looking for so far and have been able to learn a lot from the presentations! I will definitely use the app for a class assignment! And of course it also helps a lot as an inspiration.

Stefan S

iOS user

This app is really great. There are so many study notes and help [...]. My problem subject is French, for example, and the app has so many options for help. Thanks to this app, I have improved my French. I would recommend it to anyone.

Samantha Klich

Android user

Wow, I am really amazed. I just tried the app because I've seen it advertised many times and was absolutely stunned. This app is THE HELP you want for school and above all, it offers so many things, such as workouts and fact sheets, which have been VERY helpful to me personally.

Anna

iOS user

I think it’s very much worth it and you’ll end up using it a lot once you get the hang of it and even after looking at others notes you can still ask your Artificial intelligence buddy the question and ask to simplify it if you still don’t get it!!! In the end I think it’s worth it 😊👍 ⚠️Also DID I MENTION ITS FREEE YOU DON’T HAVE TO PAY FOR ANYTHING AND STILL GET YOUR GRADES IN PERFECTLY❗️❗️⚠️

Thomas R

iOS user

Knowunity is the BEST app I’ve used in a minute. This is not an ai review or anything this is genuinely coming from a 7th grade student (I know 2011 im young) but dude this app is a 10/10 i have maintained a 3.8 gpa and have plenty of time for gaming. I love it and my mom is just happy I got good grades

Brad T

Android user

Not only did it help me find the answer but it also showed me alternative ways to solve it. I was horrible in math and science but now I have an a in both subjects. Thanks for the help🤍🤍

David K

iOS user

The app's just great! All I have to do is enter the topic in the search bar and I get the response real fast. I don't have to watch 10 YouTube videos to understand something, so I'm saving my time. Highly recommended!

Sudenaz Ocak

Android user

In school I was really bad at maths but thanks to the app, I am doing better now. I am so grateful that you made the app.

Greenlight Bonnie

Android user

I found this app a couple years ago and it has only gotten better since then. I really love it because it can help with written questions and photo questions. Also, it can find study guides that other people have made as well as flashcard sets and practice tests. The free version is also amazing for students who might not be able to afford it. Would 100% recommend

Aubrey

iOS user

Best app if you're in Highschool or Junior high. I have been using this app for 2 school years and it's the best, it's good if you don't have anyone to help you with school work.😋🩷🎀

Marco B

iOS user

THE QUIZES AND FLASHCARDS ARE SO USEFUL AND I LOVE Knowunity AI. IT ALSO IS LITREALLY LIKE CHATGPT BUT SMARTER!! HELPED ME WITH MY MASCARA PROBLEMS TOO!! AS WELL AS MY REAL SUBJECTS ! DUHHH 😍😁😲🤑💗✨🎀😮

Elisha

iOS user

This app is phenomenal down to the correct info and the various topics you can study! I greatly recommend it for people who struggle with procrastination and those who need homework help. It has been perfectly accurate for world 1 history as far as I’ve seen! Geometry too!

Paul T

iOS user

The app is very easy to use and well designed. I have found everything I was looking for so far and have been able to learn a lot from the presentations! I will definitely use the app for a class assignment! And of course it also helps a lot as an inspiration.

Stefan S

iOS user

This app is really great. There are so many study notes and help [...]. My problem subject is French, for example, and the app has so many options for help. Thanks to this app, I have improved my French. I would recommend it to anyone.

Samantha Klich

Android user

Wow, I am really amazed. I just tried the app because I've seen it advertised many times and was absolutely stunned. This app is THE HELP you want for school and above all, it offers so many things, such as workouts and fact sheets, which have been VERY helpful to me personally.

Anna

iOS user

I think it’s very much worth it and you’ll end up using it a lot once you get the hang of it and even after looking at others notes you can still ask your Artificial intelligence buddy the question and ask to simplify it if you still don’t get it!!! In the end I think it’s worth it 😊👍 ⚠️Also DID I MENTION ITS FREEE YOU DON’T HAVE TO PAY FOR ANYTHING AND STILL GET YOUR GRADES IN PERFECTLY❗️❗️⚠️

Thomas R

iOS user

Knowunity is the BEST app I’ve used in a minute. This is not an ai review or anything this is genuinely coming from a 7th grade student (I know 2011 im young) but dude this app is a 10/10 i have maintained a 3.8 gpa and have plenty of time for gaming. I love it and my mom is just happy I got good grades

Brad T

Android user

Not only did it help me find the answer but it also showed me alternative ways to solve it. I was horrible in math and science but now I have an a in both subjects. Thanks for the help🤍🤍

David K

iOS user

The app's just great! All I have to do is enter the topic in the search bar and I get the response real fast. I don't have to watch 10 YouTube videos to understand something, so I'm saving my time. Highly recommended!

Sudenaz Ocak

Android user

In school I was really bad at maths but thanks to the app, I am doing better now. I am so grateful that you made the app.

Greenlight Bonnie

Android user

I found this app a couple years ago and it has only gotten better since then. I really love it because it can help with written questions and photo questions. Also, it can find study guides that other people have made as well as flashcard sets and practice tests. The free version is also amazing for students who might not be able to afford it. Would 100% recommend

Aubrey

iOS user

Best app if you're in Highschool or Junior high. I have been using this app for 2 school years and it's the best, it's good if you don't have anyone to help you with school work.😋🩷🎀

Marco B

iOS user

THE QUIZES AND FLASHCARDS ARE SO USEFUL AND I LOVE Knowunity AI. IT ALSO IS LITREALLY LIKE CHATGPT BUT SMARTER!! HELPED ME WITH MY MASCARA PROBLEMS TOO!! AS WELL AS MY REAL SUBJECTS ! DUHHH 😍😁😲🤑💗✨🎀😮

Elisha

iOS user

This app is phenomenal down to the correct info and the various topics you can study! I greatly recommend it for people who struggle with procrastination and those who need homework help. It has been perfectly accurate for world 1 history as far as I’ve seen! Geometry too!

Paul T

iOS user